ردیابی ویروس پژمردگی لکه‌ای گوجه‌فرنگی در گلخانه‌های گوجه‌فرنگی استان گلستان
پذیرفته شده برای پوستر
کد مقاله : 1740-25IPPC (R1)
نویسندگان
دانشگاه علوم کشاورزی و منابع طبیعی گرگان
چکیده
گوجه‌فرنگی(Solanum lycopersicum L.) از محصولات مهم سبزی و صیفی کشور می‌باشد که با سطح زیرکشت حدود 148 هزار هکتار و میزان تولید هفت میلیون تن، پس از سیب‌زمینی به‌عنوان دومین محصول مهم تیره Solanaceae نقش ویژه‌ای را در سبد غذایی خانوار ایفا می‌نماید. در سال‌های اخیر با توجه به گسترش گلخانه‌های گوجه‌فرنگی در ایران و از طرفی ظهور علائم مشکوک به بیماری ویروسی در این گیاه، ردیابی و شناسایی عامل بیماری ضروری است. وﻳﺮوس ﭘﮋﻣﺮدﮔﻲ ﻟﻜﻪایﮔﻮﺟﻪﻓﺮﻧﮕﻲ (tomato spotted wilt Tospovirus, TSWV) یکی از مهم‌ترین ویروس‌های آلوده‌کننده گوجه‌فرنگی است که در بیشتر مناطق دنیا، خسارت‌های زیادی را ایجاد می‌نماید. به‌منظور بررسی وجود این ویروس در گلخانه‌های گوجه‌فرنگی استان گلستان، از مناطق مختلف استان شامل شهرستان‌های رامیان، گالیکش، مینودشت، گرگان، کردکوی، علی‌آباد کتول و آزادشهر نمونه‌برداری از گیاهان مشکوک به بیماری ویروسی انجام شد. نمونه‌های مشکوک دارای علائمی مانند زردی، موزائیک، بدشکلی حاشیه و سطح برگ‌ها، روش‌شدن رگ-برگ‌ها، پیسک سطح برگ، کوتولگی بوته و پیچیدگی برگ‌ها بودند. استخراج RNA از نمونه‌های مذکور با استفاده از کیت mRNA capture (Roche) صورت گرفت. سپس تهیه cDNA و تکثیر آن با استفاده از PCR انجام شد. یک جفت آغازگر TSWV-R: AATTGCCTTGCAACCAATTC و TSWV-F: ATCAGTCGAAATGGTCGGCA، طراحی شده براساس ناحیه CP-UTR در آزمون PCR مورد استفاده قرار گرفتند. از الکتروفورز ژل آگارز یک درصد به‌منظور بررسی نتایج PCR استفاده گردید. در نهایت محصول PCR به اندازه 450 جفت باز به‌منظور تعیین توالی به شرکت ماکروژن کره جنوبی ارسال شد. توالی‌های به‌دست‌آمده، با توالی‌های موجود در بانک ژن و پایگاه اطلاعاتی NCBI، از طریق Nucleotide BLAST مورد مقایسه قرار گرفتند. سپس هم‌ردیف-سازی چندگانه و تجزیه و تحلیل تبارزایی با استفاده از داده‌های مذکور و توسط نرم‌افزار MEGA-11 انجام شد. نتایچ حاصل از این پژوهش، وجود ویروسTSWV را روی میزبان گوجه‌فرنگی از استان گلستان مورد تایید قرار داد. همچنین بررسی فیلوژنی و مقایسه شباهت‌ها و تفاوت‌ها بین جدایه‌های مختلف توسپوویروس گوجه‌فرنگی، در سطح نوکلئوتیدی و آمینواسیدی در ناحیه CP، نشان‌دهنده قرابت جدایه گرگان با TSWV از سایر مناطق ایران، از جمله جدایه زنجان با رس‌شمار KY923205 بود.
کلیدواژه ها
Title
Detection of tomato spotted wilt Tospovirus in tomato greenhouses of Golestan Province
Authors
Yeganeh bay, Saeed Nasrollahnejad, Elham Mahmoodi
Abstract
Tomato (Solanum lycopersicum L.) is one of the most important vegetables and summer crops in Iran, with a cultivated area of about 148 thousand ha and a production rate of seven million tones, it plays special roles as the second most important crop of the Solanaceae family as a food, after potato. In recent years, due to increasing the number of tomatoes growing greenhouses in Iran and also, the appearance of suspected viral disease symptoms in this plant, it is necessary to identify and characterize of the causal agent. Tomato spotted wilt virus (TSWV) is one of the most important viruses infecting tomatoes, that causes a lot of damage worldwide. To investigate the presence of this virus in tomato growing greenhouses of Golestan Province, symptomatic samples showing yellowing, mosaic, leaf deformation, vein clearing, mottling, dwarfing and leaf curling were collected in different regions including Ramian, Galikesh, Minoodasht, Gorgan, Kordkuy, Aliabad and Azadshahr. RNA extraction was done using RNA capture kit (Roche) followed by cDNA synthesis and amplification of CP-UTR by PCR using primer pair TSWV-F: ATCAGTCGAAATGGTCGGCA and TSWV-R: AATTGCCTTGCAACCAATTC. The PCR product with the size of 450 bp, was electrophoresed in 1% agarose gel and sequenced by Macrogen company (South Korea). The obtained sequences were compared with sequences available at the GenBank and NCBI database through nucleotide blast. Then, multiple alignment and phylogenetic analysis were performed using obtained data and MEGA-11 software. The results of this research confirmed the presence of TSWV on tomato plants in Golestan Province. Phylogenetic analysis and comparison of sequence identity between different isolates of TSWV at the nucleotide and amino acid levels, indicated the most identity between the Gorgan isolate and other Iranian GenBank isolates, such as Zanjan isolate with KY923205 accession number.
Keywords
Tospovirus, Coat protein, RT-PCR