ورود به سامانه عضویت

  1. صفحه اصلی
  2. مقالات منتشر شده

اولین گزارش از Grapevine geminivirus A در تاکستان‌های ایران

پذیرفته شده برای پوستر
کد مقاله : 1937-25IPPC
نویسندگان
موسسه تحقیقات گیاهپزشکی کشور، سازمان تحقیقات، آموزش و ترویج کشاورزی
چکیده
انگور از جمله محصولات باغی با قدمت کهن در جهان می‌باشد که تاکنون حدود هفتاد نوع عوامل بیمارگر داخل سلولی از آن گزارش شده‌است. به منظور بررسی وضعیت ویروس‌های با ژنوم DNA در تاکستانهای کشور، تعداد 237 نمونه از برگ و ساقه انگور با علائم مشکوک ویروسی از جمله شامل انواع پیسک، موزائیک، سبزردی، بدشکلی برگ، کاهش رشد و فاصله میانگره‌ها از استان‌های آذربایجان‌شرقی و غربی، زنجان، خراسان‌رضوی، سمنان، فارس، قزوین و کردستان جمع‌آوری و از نظر احتمال آلودگی به ویروس رگبرگ روشنی انگور (Grapevine vein clearing virus-GVCV)، ویروس همراه لکه قرمزی انگور (Grapevine red blotch associated virus-GRBaV)، ویروس همراه تغییر رنگ برگ ردیت انگور (Grapevine Roditis leaf discoloration associated virus-GRLDaV) و جمینی ویروس A انگور (Grapevine geminivirus A-GGVA) با استفاده از آغازگرهای اختصاصی به روش مولکولی PCR مورد بررسی قرار گرفتند. در این آزمون‌ها از جفت آغازگر GVCV-F1:CACGTTTCAAAGAAAGATGGAC و GVCV-R1:ATCCKTCCATGCAWCCGTCAG برای ویروس GVCV، از جفت آغازگر GVGF1:CTCGTCGCATTTGTAAGA و GVGR1:ACTGACAAGGCCTACTACG برای ویروس GRBaV، از جفت آغازگر Rt-F:AGTCGTCATCGAACAACTGCAATGC و Rt-R:GGATCCCAGAATGCTGTCCAYTC برای ویروس GRLDaV و از جفت آغازگر GGVAv541:GGCCAAGAGAAGGTTGACCTAT و GGVAc924:CATGTGGGGTTATGCTGATC برای ویروس GGVA استفاده گردید. نتایج این آزمون‌ها نشان دهنده تکثیر قطعه دی.ان.ای بطول مورد انتظار حدود 530، 557، 271 و 384 جفت باز بترتیب با آغازگرهای اختصاصی GVCV، GRBaV، GRLDaV و GGVA در 27، 18، 30 و 25 نمونه بود. در مورد هر ویروس، قطعه DNA تکثیر یافته از سه نمونه مجزا، انتخاب و توالی نوکلئوتیدی آن‌ها با استفاده از سرویس‌های تجاری تعیین گردید. مقایسه توالی‌های بدست آمده با توالی‌های نوکلئوتیدی قابل دسترس در بانک ژن (پایگاه اطلاعات NCBI) به کمک ابزار BLAST، تایید کننده مطابقت آنها با توالی‌های گزارش شده در مورد جدایه‌های GVCV، GRBaV، GRLDaV و GGVA از سایر مناطق جهان بود. ویروس‌های GVCV، GRBaV و GRLDaV قبلا از تاکستان‌های ایران شناسایی و گزارش شده‌اند ولی این اولین گزارش از شناسایی ویروس GGVA در تاکستانهای مورد بررسی در کشور می‌باشد. با توجه به قدمت کهن کشت انگور در ایران، احتمال وجود تنوع در بین جدایه‎های ویروس‌های فوق دور از انتظار نبوده و نیاز به بررسی‌های تکمیلی دارد.
کلیدواژه ها
 
Title
First report of Grapevine geminivirus A in Iranian vineyards
Authors
Reza Pourrahim, Shirin Farzadfar
Abstract
Grapes are one of the world’s most ancient fruit crops, from which about 70 infectious intracellular pathogens have been reported. To investigate the situation of viruses with DNA genome in the country's vineyards, 237 samples of grape leaves and stems showing various mottle, mosaic, chlorosis, leaf deformation, reduced growth, and internodes were collected from the provinces of East and West Azerbaijan, Zanjan, Khorasan-Razavi, Semnan, Fars, Qazvin, and Kurdistan. The presence of Grapevine vein clearing virus-GVCV, Grapevine red blotch associated virus-GRBaV, Grapevine Roditis leaf discoloration associated virus-GRLDaV, and Grapevine geminivirus A-GGVA were investigated using specific primers by molecular PCR method. Primer pairs were GVCV-F1:CACGTTTCAAAGAAAGATGGAC and GVCV-R1:ATCCKTCCATGCAWCCGTCAG for GVCV, GVGF1:CTCGTCGCATTTGTAAGA and GVGR1:ACTGACAAGGCCTACTACG for GRBaV, Rt-F:AGTCGTCATCGAACAACTGCAATGC and Rt-R:GGATCCCAGAATGCTGTCCAYTC for GRLDaV, and GGVAv541:GGCCAAGAGAAGGTTGACCTAT and GGVAc924:CATGTGGGGTTATGCTGATC for GGVA. The results showed the amplification of the DNA fragments with the expected size of about 530, 557, 271, and 384 bp using specific primers to GVCV, GRBaV, GRLDaV, and GGVA in 27, 18, 30, and 25 samples, respectively. DNA amplicons of three samples in each virus were selected and their nucleotide sequences were determined using commercial services. Comparison of the obtained sequences with available nucleotide sequences in the GenBank (NCBI database) using the BLAST tool confirmed their correspondence with the previously reported sequences of GVCV, GRBaV, GRLDaV, and GGVA isolates from other regions of the world. GVCV, GRBaV, and GRLDaV have already been identified in Iranian vineyards, but this is the first report of GGVA identification in the country's surveyed vineyards. Considering the ancient history of grape cultivation in Iran, the possibility of genetic variation among the identified viruses is not far from expected and needs additional investigations.
Keywords
Detection, virus, Emerging