اولین گزارش از آلودگی یونجه به ویروس رگه‌ای گذرای یونجه (lucerne transient streak virus) در ایران

Alfalfa (Medicago sativa L.) is the world's most important forage legume crop and viral diseases are one of the important factors in yield reduction in alfalfa. During the summer of 2024, alfalfa plants showing reduced growth, mottle, mosaic, and deformed leaves were observed and sampled from alfalfa fields in Bahar County, Hamadan Province. The samples were tested using ELISA method and specific antibodies for possible infection with alfalfa mosaic virus (AMV), bean common mosaic virus (BCMV), bean yellow mosaic virus (BYMV), peanut stunt virus (PStV) and cucumber mosaic virus (CMV). Based on the results of the ELISA test, out of 138 tested samples, 46, 31, 25, 52, and 28 samples showed positive reactions with AMV, BCMV, BYMV, PStV, and CMV antibodies, respectively, which indicated that some samples were co-infected with multiple viruses. Eleven samples with mosaic and leaf deformity symptoms did not react positively with any of the above antibodies. According to the type of their symptoms, these samples were tested for possible infection with lucerne transient streak virus (LTSV) using the RT-PCR method and specific primers LTSV.F1:GGATCGTTGCTATCTCCAAT and LTSV.R1:CGAAAACCATCATACGGCTA. The results showed the amplification of a DNA fragment with the expected length of 1033 bp in 4 out of the 11 samples. In the case of three samples, the DNA amplicons obtained from the RT-PCR reaction were sequenced and compared with the available nucleotide sequences in GenBank (NCBI database) using the BLAST tool. All three sequences shared the highest percentage of identity (96.7 to 98.5%) with the sequences previously reported for LTSV isolates from other regions of the world. Mechanical inoculation of LTSV-infected leaf extracts on Chenopodium amaranticolor and C. quinoa caused chlorotic and necrotic lesions in the inoculated leaves, and subsequently, deformity in new leaves. Systemic infection of the virus in the inoculated plants was confirmed using RT-PCR tests. This is the first report of the occurrence of LTSV in alfalfa fields in Iran. LTSV is a member of the genus Sobemovirus, and so far, no specific natural vector has been reported for this virus. Considering the importance of alfalfa cultivation in the country, additional investigation is necessary to identify the frequency and distribution of LTSV.